View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_high_27 (Length: 295)
Name: NF16281_high_27
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 70 - 271
Target Start/End: Original strand, 33358153 - 33358356
Alignment:
| Q |
70 |
aaattgatagcattgtccaaacttctttggtgattttccaaacttattggaacttaaatttcaatagacnnnnnnnnn--cttcttaaaagtgtaactgg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33358153 |
aaattgatagcattgtccaaacttctttggtgattgtccaaacttattggaacttaaatttcaatagactttttttttttcttcttaaaagtgtaactgg |
33358252 |
T |
 |
| Q |
168 |
aattttaagcaattgatggaggtttttcagcaatctccaacttcattagctggcctttataacttatccaaagcccaaagattaatcaacactcgatacg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33358253 |
aattttaagcaattgatggaggtttttcagcaatctccaacttcattagctggcctttataacttatccaaagcccaaagattaatcaacactcgatacg |
33358352 |
T |
 |
| Q |
268 |
gatg |
271 |
Q |
| |
|
|||| |
|
|
| T |
33358353 |
gatg |
33358356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University