View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_high_33 (Length: 261)
Name: NF16281_high_33
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 51116060 - 51115825
Alignment:
| Q |
8 |
tgagatgaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccactggtgaagttgctgaaaacagtctccgaaatgatgtgtacact |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51116060 |
tgagatcaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccaccggtgaagttgctgaagacagtctccgaaatgatgtgtacact |
51115961 |
T |
|
| Q |
108 |
gcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtttgggttactacgtgattcagt |
207 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51115960 |
gcggctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgcctcgttaccgagcctgatggtttgggttattacgtgattcagt |
51115861 |
T |
|
| Q |
208 |
gggctgcactcaacaaccatactgctgttgctcagt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51115860 |
gggctgcactcaacaaccatactgctgttgctcagt |
51115825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 64 - 239
Target Start/End: Complemental strand, 51106668 - 51106493
Alignment:
| Q |
64 |
ctggtgaagttgctgaaaacagtctccgaaatgatgtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttg |
163 |
Q |
| |
|
|||||| ||| |||||| |||| |||| || ||||| |||| ||| ||||||||| ||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
51106668 |
ctggtggagtcgctgaagacagactccagaaggatgtttacattgcgactgcttatgaggatttagagaagctacgtagattggtggagcaagagggttg |
51106569 |
T |
|
| Q |
164 |
ccttgttaccgagcctgatggtttgggttactacgtgattcagtgggctgcactcaacaaccatactgctgttgct |
239 |
Q |
| |
|
||| |||||||||||||||| | ||||||||||| | ||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
51106568 |
cctcgttaccgagcctgatgctacgggttactacgcgcttcagtgggctgcactcaacaaccaaacttctgttgct |
51106493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 99 - 243
Target Start/End: Original strand, 48032818 - 48032962
Alignment:
| Q |
99 |
gtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtttgggttactacg |
198 |
Q |
| |
|
||||||||||| || |||||||| |||||||||||||| | ||||||||||||| || ||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
48032818 |
gtgtacactgccgcggcttatggggatttggagaagctacatagattggtggagattgaaggttgtcttgttaacgagcctgatggtttgggttactacg |
48032917 |
T |
|
| Q |
199 |
tgattcagtgggctgcactcaacaaccatactgctgttgctcagt |
243 |
Q |
| |
|
||||||||||||| || || |||| ||||||| |||||||| |
|
|
| T |
48032918 |
ctcttcagtgggctgctcttaataaccgcactgctgctgctcagt |
48032962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University