View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_high_34 (Length: 261)
Name: NF16281_high_34
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 13 - 152
Target Start/End: Complemental strand, 35278815 - 35278675
Alignment:
| Q |
13 |
aaaattaatttaatattcgatttaagaacggactaatttgaaagactaaccctttcgtccagctgttgaacccctactaaagctctaaaaagtaaaaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||| | | |||||||||||||||||||||||||||||||||| |
|
|
| T |
35278815 |
aaaattaatttaatattcgatttaagaacggattaatttgaaagagtaacccttccgtccaccggctgaacccctactaaagctctaaaaagtaaaaatg |
35278716 |
T |
|
| Q |
113 |
tgtt-gaattatctattgccatcttccatgattgatcatag |
152 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35278715 |
tgttagaattatctatggccatcttccatgattgatcatag |
35278675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 206 - 261
Target Start/End: Complemental strand, 35278621 - 35278566
Alignment:
| Q |
206 |
cgaattgcatgattgttgatttttaaacacaacgaaaaatatttggtgacaaaaga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35278621 |
cgaattgcatgattgttgatttttaaacacaacgaaaaatatttggtgacaaaaga |
35278566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University