View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_high_51 (Length: 216)
Name: NF16281_high_51
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 40769834 - 40770016
Alignment:
| Q |
18 |
aattctacctctcaaataaacaaaagagttgcatttgtcaagtgtcatggccgtgttcagtgtgagaagcatcaacaaaaagaatggtggaggtggcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40769834 |
aattctacctctcaaataaacaaaagagttgcatttgtcaagtgtcatggccgtgttcagtgtgagaagcatcaacaaaaagaatggtggaggtggcatt |
40769933 |
T |
 |
| Q |
118 |
gtgaagctcattgagaagctacagaagaaaattgtaatagggagaaacaaatcaacatcaacctatgtgcctgaggatgtaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40769934 |
gtgaagctcattgagaagctacagaagaaaatagtaatagggagaaacaaatcaacatcaacctatgtgcctgaggatgtaaa |
40770016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University