View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_high_8 (Length: 448)
Name: NF16281_high_8
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 440
Target Start/End: Complemental strand, 21298132 - 21297693
Alignment:
| Q |
1 |
ctcatttttctgcaggaaatctcaaactttggctagtagcttctgcccaaatcgatcatctaggctgccccttactactcgatgttaatgaacatgaagt |
100 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| | |||| |||| || ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21298132 |
ctcatgtttatgcaggaaatctcaaactttggcaaaaagctgctgcgcagatcgatcatctaggctgccccgtactactcgatgttaatgaacatgaagt |
21298033 |
T |
 |
| Q |
101 |
agtaaacaattgggcctctttccttggctttgacgaatctattgaatggttcagcaccctcaattatatgatgtctaattactgccaattttggagagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21298032 |
agtaaacaattgggcctctttccttggctttgacgaatctattgaatggttcggcaccctcaattatatgatgtctaattactgccaattttggagagcg |
21297933 |
T |
 |
| Q |
201 |
tctcaaccgctttctgaatgctcacccaatggatctgctgctggagctgtcgtctgccgacaactctctggttccttattcaacgaacctggatggaatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
21297932 |
tctcaaccgctttctgaatgctcacccaatggatctgctgctggagttgtcgtctgccgacaactctctggttccttattcaacgaacctggctggattg |
21297833 |
T |
 |
| Q |
301 |
ctcaatcaggcacccacactgcaacaatccacggaagcgacaaccaagttggacactactcgatgaaccaaactcccactctcaacttctctgcctctac |
400 |
Q |
| |
|
| ||||||||||||| || |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21297832 |
cgcaatcaggcacccgcaatgcaacaacccacagaagcgacaaccaagttggacactactcgatgaaccaaactcccactctcaacttctctgcctctac |
21297733 |
T |
 |
| Q |
401 |
aacaatcgaagacatacctgaatcccatctctgtgctgct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21297732 |
aacaatcgaagacatacctgaatcccatctttgtgctgct |
21297693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University