View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_low_24 (Length: 332)
Name: NF16281_low_24
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 172 - 316
Target Start/End: Original strand, 40464099 - 40464243
Alignment:
| Q |
172 |
ggttatatttttagtctataatagaccatcaaaatttaccaacacatatatgaccaataatatttattagtatctcttatatactaaatcatagtagtga |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||| |
|
|
| T |
40464099 |
ggttatatttttagtctataatagaccatcaaaatttaccaaaacatatatgaccaataatatttactagtatctcttatatactacatcgtagtagtga |
40464198 |
T |
|
| Q |
272 |
ttcactaagttttgaaatgattcacaagtttaatagtggattcag |
316 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40464199 |
ttcactaatttttggaatgattcacaagtttaatagtggattcag |
40464243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University