View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16281_low_35 (Length: 261)

Name: NF16281_low_35
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16281_low_35
NF16281_low_35
[»] chr1 (2 HSPs)
chr1 (8-243)||(51115825-51116060)
chr1 (64-239)||(51106493-51106668)
[»] chr4 (1 HSPs)
chr4 (99-243)||(48032818-48032962)


Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 51116060 - 51115825
Alignment:
8 tgagatgaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccactggtgaagttgctgaaaacagtctccgaaatgatgtgtacact 107  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||    
51116060 tgagatcaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccaccggtgaagttgctgaagacagtctccgaaatgatgtgtacact 51115961  T
108 gcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtttgggttactacgtgattcagt 207  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
51115960 gcggctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgcctcgttaccgagcctgatggtttgggttattacgtgattcagt 51115861  T
208 gggctgcactcaacaaccatactgctgttgctcagt 243  Q
    ||||||||||||||||||||||||||||||||||||    
51115860 gggctgcactcaacaaccatactgctgttgctcagt 51115825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 64 - 239
Target Start/End: Complemental strand, 51106668 - 51106493
Alignment:
64 ctggtgaagttgctgaaaacagtctccgaaatgatgtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttg 163  Q
    |||||| ||| |||||| |||| ||||  || ||||| |||| |||  |||||||||  ||||| |||||||| ||||||||||||||||||||||||||    
51106668 ctggtggagtcgctgaagacagactccagaaggatgtttacattgcgactgcttatgaggatttagagaagctacgtagattggtggagcaagagggttg 51106569  T
164 ccttgttaccgagcctgatggtttgggttactacgtgattcagtgggctgcactcaacaaccatactgctgttgct 239  Q
    ||| |||||||||||||||| |  ||||||||||| | ||||||||||||||||||||||||| ||| ||||||||    
51106568 cctcgttaccgagcctgatgctacgggttactacgcgcttcagtgggctgcactcaacaaccaaacttctgttgct 51106493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 99 - 243
Target Start/End: Original strand, 48032818 - 48032962
Alignment:
99 gtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtttgggttactacg 198  Q
    ||||||||||| || |||||||| |||||||||||||| | |||||||||||||   || ||||| ||||||| ||||||||||||||||||||||||||    
48032818 gtgtacactgccgcggcttatggggatttggagaagctacatagattggtggagattgaaggttgtcttgttaacgagcctgatggtttgggttactacg 48032917  T
199 tgattcagtgggctgcactcaacaaccatactgctgttgctcagt 243  Q
       ||||||||||||| || || ||||  ||||||| ||||||||    
48032918 ctcttcagtgggctgctcttaataaccgcactgctgctgctcagt 48032962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University