View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_low_41 (Length: 249)
Name: NF16281_low_41
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 52242896 - 52243120
Alignment:
| Q |
1 |
aattgcaaaaccacataatacaatatggataaagtgtgaataatttgtgatactaaataaatcaaatgtctacatattgtaactgaaatcaaaatgaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242896 |
aattgcaaaaccacataatacaatatggataaagtgtgaataatttgtgatactaaataaatcaaatgtctacatattgtaactgaaatcaaaatgaaca |
52242995 |
T |
 |
| Q |
101 |
caccacagcctctcattctacnnnnnnnnnnnnggcttctgtccttttctttcagcaatactttgtttctttgctaacatcccccaaattcaaatactcc |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242996 |
caccacagcctctcattctac------ctctctggcttctgtccttttctttcagcaatactttgtttctttgctaacatcccccaaattcaaatactcc |
52243089 |
T |
 |
| Q |
201 |
aatttaatttaaaaacatttctaaaactttc |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
52243090 |
aatttaatataaaaacatttctaaaactttc |
52243120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University