View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_low_45 (Length: 241)
Name: NF16281_low_45
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 39757386 - 39757176
Alignment:
| Q |
16 |
tatactgtagataatagaaaagtatgacctgagaaggtgtactactattcaaagattttagttgcgcgcttacgagtttgctattgcggatatcatgcct |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39757386 |
tataccgtagataatagaaaagtatgacctgagaaggtgtactactattcaaagattttagttgcgcgcttacgagtttgctattgcggatatcatgcct |
39757287 |
T |
 |
| Q |
116 |
aagctctatgtttccgtcacttgaccaccattgtttcatgctatgagcctcgagaaatttctggttttcctttgagacaacaaacaacttggcttcattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39757286 |
aagctctatgtttccgtcacttgaccaccattgtttcatgctatgagcctcgagaaatttctggttttcctttgagacaacaaacaacttggcttcattt |
39757187 |
T |
 |
| Q |
216 |
tgctgatttgt |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
39757186 |
tgctgatttgt |
39757176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 42 - 225
Target Start/End: Complemental strand, 39763799 - 39763616
Alignment:
| Q |
42 |
acctgagaaggtgtactactattcaaagattttagttgcgcgcttacgagtttgctattgcggatatcatgcctaagctctatgtttccgtcacttgacc |
141 |
Q |
| |
|
|||| ||||||||||| | | ||||||||||| |||||| |||| || ||||||| |||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39763799 |
acctcagaaggtgtaccagtgttcaaagatttaagttgcacgctcacaagtttgccattgcggatatcatgcttaagctctatgttaccgtcacttgacc |
39763700 |
T |
 |
| Q |
142 |
accattgtttcatgctatgagcctcgagaaatttctggttttcctttgagacaacaaacaacttggcttcattttgctgatttg |
225 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||||||| || |||| |||||||||||||||| |||| ||||| |
|
|
| T |
39763699 |
accattgtttcaagccatgagcctcgagaaatttctggtcttcctttgtgataacatacaacttggcttcattgtgctcatttg |
39763616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 202
Target Start/End: Complemental strand, 39747228 - 39747161
Alignment:
| Q |
135 |
cttgaccaccattgtttcatgctatgagcctcgagaaatttctggttttcctttgagacaacaaacaa |
202 |
Q |
| |
|
|||||||||||||||| || | ||||||||| |||||||| || |||||||| || ||||||||||| |
|
|
| T |
39747228 |
cttgaccaccattgttccaatccatgagcctcaagaaatttttgtttttccttagacacaacaaacaa |
39747161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University