View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_low_55 (Length: 213)
Name: NF16281_low_55
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 200
Target Start/End: Complemental strand, 22348257 - 22348067
Alignment:
| Q |
13 |
agcagagagccagcgctggagttcaggcgccaggaaccatcagaaacgcaattttcgttgcaaatgagcgtagaattgatcctactactagggttgatta |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22348257 |
agcagagagccagtgctggagttcaggcgccaggaaccatcagaaacgcaattttcattgcaaatgagcgtagaattgatcctactactagggttgatta |
22348158 |
T |
 |
| Q |
113 |
tgttaatgcaaagttaataatgttggtgctat---aatatggtaaaggctgccagatgtatttacatatctatgtactgtatgatgaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22348157 |
tgttaatgcaaagttaataatgttggtgctatcgatatatggtaatggctgccagatgtatttacatatctatgtactgtatgatgaaact |
22348067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University