View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16283_high_11 (Length: 279)

Name: NF16283_high_11
Description: NF16283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16283_high_11
NF16283_high_11
[»] chr1 (1 HSPs)
chr1 (14-141)||(47192364-47192491)
[»] chr8 (8 HSPs)
chr8 (14-141)||(1668704-1668831)
chr8 (14-141)||(16659498-16659625)
chr8 (14-141)||(38520619-38520746)
chr8 (14-141)||(22015512-22015639)
chr8 (195-256)||(1668885-1668946)
chr8 (195-256)||(16659679-16659740)
chr8 (195-256)||(38520504-38520565)
chr8 (195-256)||(22015693-22015754)
[»] chr4 (6 HSPs)
chr4 (14-141)||(23217613-23217740)
chr4 (14-141)||(45153397-45153524)
chr4 (14-141)||(45144617-45144744)
chr4 (195-256)||(23217498-23217559)
chr4 (195-256)||(45144798-45144859)
chr4 (195-256)||(45153578-45153639)
[»] chr3 (4 HSPs)
chr3 (14-141)||(2338209-2338336)
chr3 (14-141)||(21239766-21239893)
chr3 (195-256)||(2338094-2338155)
chr3 (195-256)||(21239947-21240008)
[»] chr5 (2 HSPs)
chr5 (14-141)||(3174842-3174969)
chr5 (195-256)||(3175023-3175084)
[»] chr2 (4 HSPs)
chr2 (14-141)||(3934686-3934813)
chr2 (14-141)||(38975059-38975186)
chr2 (195-256)||(3934572-3934632)
chr2 (203-256)||(38974950-38975003)
[»] scaffold0393 (2 HSPs)
scaffold0393 (52-141)||(10948-11037)
scaffold0393 (195-256)||(10833-10894)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 47192364 - 47192491
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
47192364 agagaagaatagttatttatgatcaagtaaaaccttagaaaagaactttgagtttgacaactagatagagcaagagccataggagagatcatggtttagt 47192463  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||||||| ||||||||||||||||||||    
47192464 atttggacctgtccgggccttgctgcca 47192491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 1668704 - 1668831
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1668704 agagaagaagagttatttatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 1668803  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
1668804 attcggagctgtctgtgccttactgcca 1668831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 16659498 - 16659625
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16659498 agagaagaagagttatttatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 16659597  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
16659598 attcggagctgtctgtgccttactgcca 16659625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 38520746 - 38520619
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38520746 agagaagaagagttatttatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 38520647  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
38520646 attcggagctgtctgtgccttactgcca 38520619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 22015512 - 22015639
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||| ||||| || | ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||    
22015512 agagaagaagagttattcatgataaaatgaaaccttagaaaagaactttgagtttcacaactagctagagcaagagccataggagagatcatagtttagt 22015611  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
22015612 attcggagctgtctgtgccttactgcca 22015639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Original strand, 1668885 - 1668946
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
1668885 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 1668946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Original strand, 16659679 - 16659740
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
16659679 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 16659740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Complemental strand, 38520565 - 38520504
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
38520565 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 38520504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 195 - 256
Target Start/End: Original strand, 22015693 - 22015754
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| ||||||||||||||||||||| || | ||| |||||||||    
22015693 agcagatcagcgctgcttgcagctgtttttctgtctttggtggatgcttttcaatgatgctt 22015754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 23217740 - 23217613
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23217740 agagaagaagagttatttatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 23217641  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
23217640 attcggagctgtctgtgccttactgcca 23217613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 45153397 - 45153524
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45153397 agagaagaagagttatttatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 45153496  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
45153497 attcggagctgtctgtgccttactgcca 45153524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 45144617 - 45144744
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||| ||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45144617 agagaagaagagttattcatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 45144716  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
45144717 attcggagctgtctgtgccttactgcca 45144744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Complemental strand, 23217559 - 23217498
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
23217559 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 23217498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Original strand, 45144798 - 45144859
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
45144798 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 45144859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Original strand, 45153578 - 45153639
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
45153578 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 45153639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 2338336 - 2338209
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2338336 agagaagaagagttatttatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 2338237  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
2338236 attcggagctgtctgtgccttactgcca 2338209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 21239766 - 21239893
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21239766 agagaagaagagttatttatgataaaatgaaacctttgaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 21239865  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
21239866 attcggagctgtctgtgccttactgcca 21239893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Complemental strand, 2338155 - 2338094
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
2338155 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 2338094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Original strand, 21239947 - 21240008
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
21239947 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 21240008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 3174842 - 3174969
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||| ||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3174842 agagaagaagagttattcatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 3174941  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
3174942 attcggagctgtctgtgccttactgcca 3174969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Original strand, 3175023 - 3175084
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
3175023 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 3175084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 3934813 - 3934686
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3934813 agagaagaagagttatttatgataaaatgaaaccttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 3934714  T
114 atttggagctgtccgggccttgctgcca 141  Q
    |||  |||||||| | ||||| ||||||    
3934713 attcagagctgtctgtgccttactgcca 3934686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 38975186 - 38975059
Alignment:
14 agagaagaatagttatttatgatcaagtaaaatcttagaaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagt 113  Q
    ||||||||| ||||||| ||||| || | ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
38975186 agagaagaagagttattcatgataaaatgaaaccttagaaaagaactttgagtttgacaactagcttgagcaagagccataggagagatcatggtttagt 38975087  T
114 atttggagctgtccgggccttgctgcca 141  Q
    ||| ||||||||| | ||||| ||||||    
38975086 attcggagctgtctgtgccttactgcca 38975059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 195 - 256
Target Start/End: Complemental strand, 3934632 - 3934572
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| ||| |||||||||||||||||||| | ||| |||||||||    
3934632 agcagatcagcgctgcttgcagctg-ttttctgtctttggtggttgcttttcaatgatgctt 3934572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 256
Target Start/End: Complemental strand, 38975003 - 38974950
Alignment:
203 agcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
38975003 agcgctgcttgcagctgtttttctgtctttggtggttgcttttcaatgatgctt 38974950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0393 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: scaffold0393
Description:

Target: scaffold0393; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 52 - 141
Target Start/End: Complemental strand, 11037 - 10948
Alignment:
52 aaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagtatttggagctgtccgggccttgctgcca 141  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||| ||||||    
11037 aaaagaactttgagtttgacaactagctagagcaagagccataggagagatcatggtttagtatttagagctgtctgtgccttactgcca 10948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0393; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Complemental strand, 10894 - 10833
Alignment:
195 agcagatcagcgctgcttgcaactgtttttctgtctttggtggttgttgttcgatgatgctt 256  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| | ||| |||||||||    
10894 agcagatcagcgctgcttgcagctgtttttctgtctttggtggttggttttcaatgatgctt 10833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University