View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16283_high_6 (Length: 312)
Name: NF16283_high_6
Description: NF16283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16283_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 71 - 300
Target Start/End: Complemental strand, 303927 - 303698
Alignment:
| Q |
71 |
cataaaagagttgaaatattattatagttgagcaagttggtgaatgttgataggataaacaaaattggtattgccattaaaagccatccttcccataaga |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303927 |
catagaagagttgaaatattattatagttgagcaagttggtgaatgttgataggataaacaaaattggtattgccattaaaagccatccttcccataaga |
303828 |
T |
|
| Q |
171 |
atgttaactgcttctgttggatgaaatgcatcccaaaacacataacggtttctattagggcatggagtttggaatggtagacaagttatttgacctctgt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303827 |
atgttaactgcttctgttggatgaaatgcatcccaaaacacataacggtttctattagggcatggagtttggaatggtagacaagttatttgacctctgt |
303728 |
T |
|
| Q |
271 |
ttcttccaagcccacaacaccctctattca |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
303727 |
ttcttccaaggccacaacaccctctattca |
303698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 304022 - 303968
Alignment:
| Q |
18 |
atcatcgatcatatgacaattttaattggaaatcaagctaggaagcaatacacca |
72 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
304022 |
atcatcgattatatgacaattttaattggaaatcaagctaggaagcaatacacca |
303968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University