View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16283_low_14 (Length: 260)
Name: NF16283_low_14
Description: NF16283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16283_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 38338261 - 38338493
Alignment:
| Q |
17 |
aagagccatcataagttgaggtatcccaagtggaagtttatcacctctatcaacttgccagaaatgatagactttaccataagttttgcaaactttctcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38338261 |
aagagccatcataagttgaggtatcccaagtggaagtttatcacctctatcaacttgccagaaatgatagactttaccataagttttgcaaactttctcc |
38338360 |
T |
 |
| Q |
117 |
atgtctttgtgctcaatgggtttagggacatttggcatgaagaggaaaccactctttacctcgaacaaatgagaatgccagagtcgcttctcctcgtccg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38338361 |
atgtctttgtgctcaatgggtttagggacatttggcatgaagaggaaaccactctttacctcgaacaaatgagaatgccagagtcgcttctcctcgtccg |
38338460 |
T |
 |
| Q |
217 |
gtagagtcaggaacaagttctcagagatgatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
38338461 |
gtagagtcaggaacaagttctcagatatgatgt |
38338493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University