View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16283_low_15 (Length: 253)
Name: NF16283_low_15
Description: NF16283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16283_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 171
Target Start/End: Original strand, 28320345 - 28320499
Alignment:
| Q |
17 |
aatcattcatgggtataaatggagtaagaatctccatatttcccttaacttttatgagaaatgatattttattttttagcgtaaatcagatatcatttcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28320345 |
aatcattcatgggtataaatggagtaagaatctccatatttcccttaacttttatgagaaatgatattttattttttagcgtaaatcagatatcatttcc |
28320444 |
T |
 |
| Q |
117 |
acgaacaactgcaaagactaatatcttaagctttgtaggatttaaataaacgata |
171 |
Q |
| |
|
|||| |||||||||||| ||||||| || ||||||||||| |||||||||||| |
|
|
| T |
28320445 |
acgatcaactgcaaagattaatatcacaaattttgtaggattcaaataaacgata |
28320499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University