View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16284_high_3 (Length: 468)
Name: NF16284_high_3
Description: NF16284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16284_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-113
Query Start/End: Original strand, 235 - 454
Target Start/End: Complemental strand, 12748235 - 12748016
Alignment:
| Q |
235 |
caacctttttaagaagaacagattcagggaagaagccggtggcttcatctgatttgggcacaaagctatgagtatcttctttcttatctttcttccgggc |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12748235 |
caacctttttaagaagaacagattcagggaagaagccggtggcttcatatgatttgggcacaaagctatgagtatcttctttcttatctttcttccgggc |
12748136 |
T |
|
| Q |
335 |
attcataatgagtgagaatgattttctggggttattttgtagagaaaattggcgtgaaaacaatgacgatgaagaaaggtggtgatttgggaaattgaaa |
434 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12748135 |
attcataatgagtgagaatgattttctggggttattttgtagagaaaattggcgtgaaaacgatgaggatgaagaaaggtggtgatttgggaaattgaaa |
12748036 |
T |
|
| Q |
435 |
cgaagagggtttgatgctaa |
454 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12748035 |
cgaagagggtttgatgctaa |
12748016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 11 - 114
Target Start/End: Complemental strand, 12748459 - 12748356
Alignment:
| Q |
11 |
ttatacttaaacaaaaccaatgaaaactagcagaaattatactaaatggtatagtataccaaaacaaatttgagggtattgcaaattctaccaacttata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12748459 |
ttatacttaaacaaaaccaatgaaaactagcagaaattatactaaaatgtatagtataccaaaacaaatttgagggtattgcaaattctaccagcttata |
12748360 |
T |
|
| Q |
111 |
agta |
114 |
Q |
| |
|
|||| |
|
|
| T |
12748359 |
agta |
12748356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University