View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16284_low_20 (Length: 228)
Name: NF16284_low_20
Description: NF16284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16284_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 384071 - 383877
Alignment:
| Q |
19 |
tttgtttggctaatgtatgtccttcaagcagcagatagttgcccatgcttcttgttttatatacgcacttctattggtcggcttccaagcgtgtgaacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
384071 |
tttgtttggctaatgtatgtccttcaagcagcagatagttgcctatgcttcttgttttatatacgcacttctattggttggcttccaagcgtgtgaacaa |
383972 |
T |
|
| Q |
119 |
tattaaatcatggctttgtttggctaatatatgttcttcaagcagatagttgcctatatttcttgttttatatatgctcttggattatgcctatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
383971 |
tattaaatcatggctttgtttggctaatatatgttcttcaagcagatagttgcctatatttcttgttttatatatgctcttggattatgcctatg |
383877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 125 - 192
Target Start/End: Complemental strand, 384079 - 384009
Alignment:
| Q |
125 |
atcatggctttgtttggctaatatatgttcttca---agcagatagttgcctatatttcttgttttatata |
192 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
384079 |
atcatgtctttgtttggctaatgtatgtccttcaagcagcagatagttgcctatgcttcttgttttatata |
384009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 12534923 - 12534870
Alignment:
| Q |
157 |
caagcagatagttgcctatatttcttgttttatatatgctcttggattatgcct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
12534923 |
caagcagatagtttcctatgtttcttgttttatatatgctctacgattatgcct |
12534870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University