View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16287_high_9 (Length: 300)
Name: NF16287_high_9
Description: NF16287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16287_high_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 113 - 300
Target Start/End: Complemental strand, 4159634 - 4159447
Alignment:
| Q |
113 |
atgaacaagaaaataatattacaattggtatgatttaattacctgggtgaccaggaagatttctcttccttttggtttgtggttccagatttgttgaagc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4159634 |
atgaacaagaaaataatattacaattggtatgatttaattacctgggtgaccaggaagatttctcttccttttggtttgtggttccagatttgttgaagc |
4159535 |
T |
 |
| Q |
213 |
ttttccattcttggttgctgaagaagcacttatttcacttgaagcagatgtcaaatttgacatattttcatctaccgacaaacctttc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4159534 |
ttttccattcttggttgctgaagaagcacttatttcacttgaagcagatgtcaaatttgacatattttcttctaccgacaaacctttc |
4159447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University