View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16287_low_1 (Length: 221)
Name: NF16287_low_1
Description: NF16287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16287_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 17 - 123
Target Start/End: Original strand, 52512981 - 52513087
Alignment:
| Q |
17 |
aataattaaaactaagaagtgacttacaaagtgatgtttggggtccaagagtgggtggtggttcctccaacaactctataggatgtggtactggataaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
52512981 |
aataattaaaactaagaagtgacttacaaagtgatgtttggggtccaagagtgggtggtggtggttcctccaactgtataggatggggtactggataaag |
52513080 |
T |
 |
| Q |
117 |
aagaaac |
123 |
Q |
| |
|
||||||| |
|
|
| T |
52513081 |
aagaaac |
52513087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 148 - 205
Target Start/End: Original strand, 52513106 - 52513162
Alignment:
| Q |
148 |
ttggtcttggagatgatggagatttgtagattccataatgataaaaatttataattgc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52513106 |
ttggtcttggagatgatggagatttgtagattccataatgat-aaaatttataattgc |
52513162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University