View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16288_low_10 (Length: 227)
Name: NF16288_low_10
Description: NF16288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16288_low_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 18551662 - 18551436
Alignment:
| Q |
1 |
tcatcatctacctcaatgtttcgattcctgaggctgcgaatttgaatgctcttcatacgaagaacaatcaagcttatgcaccaaacccttagctggaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
18551662 |
tcatcatctacctcaatgtttcgattcctgaggctgcgaatttgaatgcccttcatacgaagaacaatcaagcttatgcaccaaacccttagctgaaagc |
18551563 |
T |
|
| Q |
101 |
gaaagaagcaaaaatatggcgatcctaagtactgattccatactctatctctaacactgtttatgctttcctagggcctttaccagattctattatggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18551562 |
gaaagaagcaaaaatatggcgatcctaagtactgattccatactctgtctctaacactatttatgctttcctagggcctttaccagattctactatggct |
18551463 |
T |
|
| Q |
201 |
tttgatgacattaagaaaatcttcctt |
227 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
18551462 |
tttgataacattaagaaaatcttcctt |
18551436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University