View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16288_low_9 (Length: 243)
Name: NF16288_low_9
Description: NF16288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16288_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 18551189 - 18551430
Alignment:
| Q |
2 |
gaaatgaatggcagcaaagagcgggttgacatcatacttagggccagccctggaaaattggataaggtcaaaaataccaaaagttttaccaaagttggga |
101 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18551189 |
gaaatgaatggcaggaaagagcaggttgacatcatacttagggccagccctggaaaattggataaggtcaaaaataccaaaagttttaccaaagttggga |
18551288 |
T |
 |
| Q |
102 |
ttttttaagttctattttgtctgaacacttgacataagtaaggttactagtggaatgggctgatcaaaacactttatgtgttgtattcatgaaactcata |
201 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18551289 |
ttttttaagttctattttgtctgaccacttgacataagtaaggttactagtggaatgggctgatcaaaacactttatgtgttgtattcatgaaactcata |
18551388 |
T |
 |
| Q |
202 |
ttataaggaccttcagagaatatcttgggggtttcaccctca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18551389 |
ttataaggaccttcagagaatatcttgggggttgcaccctca |
18551430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University