View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1628_high_2 (Length: 267)
Name: NF1628_high_2
Description: NF1628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1628_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 84 - 249
Target Start/End: Complemental strand, 31637980 - 31637816
Alignment:
| Q |
84 |
ttttttatcttgtggttttcaattatctagttgattcctaaactaaccctaattatttggaaattttgtctctactttaagcaacaatttttagtgttgg |
183 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
31637980 |
tttttaatcttgtggtattcaattatctagttgattcctaaactagccctaattatttggaaattttgtctgtactttaggcaacaattttttatgttgg |
31637881 |
T |
|
| Q |
184 |
ttgttggtgaatgccattttcaaccnnnnnnnctgagtctctccttctctcttacccctttacacc |
249 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31637880 |
ttgttggtgaataccattttcaaccaaaaaaactgagtctctccttctctc-tacccctttacacc |
31637816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 84 - 249
Target Start/End: Original strand, 31671849 - 31672013
Alignment:
| Q |
84 |
ttttttatcttgtggttttcaattatctagttgattcctaaactaaccctaattatttggaaattttgtctctactttaagcaacaatttttagtgttgg |
183 |
Q |
| |
|
||||| |||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
31671849 |
tttttaatcttgtggtattcatttatctagttgattcctaaactagccctaattatttggaaattttgtctctactttaggcaacaattttttatgttgg |
31671948 |
T |
|
| Q |
184 |
ttgttggtgaatgccattttcaaccnnnnnnnctgagtctctccttctctcttacccctttacacc |
249 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31671949 |
ttgttggtgaataccattttcaaccaaaaaaactgagtctctccttctctc-tacccctttacacc |
31672013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University