View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16290_low_2 (Length: 413)
Name: NF16290_low_2
Description: NF16290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16290_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 4e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 47077816 - 47078001
Alignment:
| Q |
20 |
taatagttctgtttttgtattaattaagagttaagactggctgtgcatttctaagtgtttatttagtatttaccactaatgtgtgccctttttatgttct |
119 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47077816 |
taatagttgtgtttttgtatta----agagttaagactggctgtgcatttctaagtgtttatttagtatttaccactaatgtgtgccctttttatgttct |
47077911 |
T |
 |
| Q |
120 |
aaacgtagcggatcgtacacgtctcctgccttagcgagtttttcttttcatgttccctcatatgtggatcctcatggggatccatatcga |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47077912 |
aaaagtagcggatcgtacacgtctcctgccttagcgagtttttcttttcatgttccctcatatgtggatcctcatggggatccatatcga |
47078001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 290 - 390
Target Start/End: Original strand, 47078085 - 47078186
Alignment:
| Q |
290 |
attgcaacattactgtgtcttatgagaacaataaaacatcgtgannnnnnnn--acacatatattgtttaaaatataaataaatataatgtatgatctat |
387 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47078085 |
attgcaacattactgtgtcttatgacaacaataaa-catcgtgattttttttttacacatatattgtttaaaatataaataaatataatgtatgatctat |
47078183 |
T |
 |
| Q |
388 |
gtc |
390 |
Q |
| |
|
||| |
|
|
| T |
47078184 |
gtc |
47078186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University