View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16290_low_4 (Length: 355)
Name: NF16290_low_4
Description: NF16290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16290_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 9 - 340
Target Start/End: Original strand, 11295656 - 11296005
Alignment:
| Q |
9 |
gataagaaaatccttaagttgggaaactct----ctctctaaccttttgtcaagtagcattccctttaagttaagtttatttgacggcaagtcaacaatg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
11295656 |
gataagaaaatccttaagttgggaaactctctctctctctaaccttttgtcaagtagcattcactttaagttaactttatttgacggcaagccaacaatg |
11295755 |
T |
 |
| Q |
105 |
ttgctcatttgttagctaaaactacaccgtgtcttataaactggataaagacatggcgaccaagtctttgataaatgaaataagttaagtttacttcagt |
204 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11295756 |
ttgctcatttgttagctaaaattacaccgtgtcttataaactggacaaagacatgacgaccaagtctttgataaatgaaataagttaagtttactttagt |
11295855 |
T |
 |
| Q |
205 |
caaaacaaaaattggaccaagacnnnnnnnngaaggaaaactgg--------------accaagtctttgacttatttatccaaaacctattaattgaca |
290 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11295856 |
caaaacaaaaattggaccaagactttttttttaaggaaaattggaccaagacttggcaaccaagtctttgacttatttatccaaaacctattaattgaca |
11295955 |
T |
 |
| Q |
291 |
aatccaaccttaatttcataccatcgaaatctcacaagttattctctctg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11295956 |
aatccaaccttaatttcataccatcgaaatctcacaagttattctctctg |
11296005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University