View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16290_low_5 (Length: 243)
Name: NF16290_low_5
Description: NF16290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16290_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 33501579 - 33501713
Alignment:
| Q |
18 |
agattgacaatgatcttggctccattgttgaaaagtgagcactcagaaaataaactgttgaatctcatatggaaaggacattgccattttactgtagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33501579 |
agattgacaatgatcttggctccattgttgaaaagtgagcactcagaaaataaactgttgaatctcatatggaaaggacattgccattttactgtagaat |
33501678 |
T |
|
| Q |
118 |
gatcgagatttaagaattatttatatttctttacc |
152 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33501679 |
ggtcgagatttaagaattatttatatttctttacc |
33501713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 243
Target Start/End: Original strand, 33501761 - 33501807
Alignment:
| Q |
200 |
gtagaacctctaaaatcaac---ttatcttgttactattatcctttt |
243 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33501761 |
gtagaacctctaaaatcaacttattatcttgttactattatcctttt |
33501807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University