View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16291_low_10 (Length: 273)
Name: NF16291_low_10
Description: NF16291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16291_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 44917949 - 44917702
Alignment:
| Q |
19 |
acgatgcatgttattgtgggtctaaattacattacattactttgttgtgggaatctttcctagatatacactaattgcattcaaattggatttgatattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44917949 |
acgatgcatgttattgtgggtctaaattacattacattactttgttgtgggaatctttcctagatatacactaattgcattcaaattggattggatattt |
44917850 |
T |
|
| Q |
119 |
actccttctttcatgtagtacttttggcatgaacttacaacatgcaataattggtacatgctgatagtgactaagaaattgtccctatagtatagacttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44917849 |
actccttctttcatgtagtacttttggcatgaacttacaacatgcaataattggtacatgctgatagtgactaagaaattgtccctatagtatagacttt |
44917750 |
T |
|
| Q |
219 |
aattattataatgttttttacttgaatttggtgttctagttcatctca |
266 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44917749 |
aattattataatgttttttactttaatttggtgttctagttcatctca |
44917702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University