View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16291_low_11 (Length: 264)
Name: NF16291_low_11
Description: NF16291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16291_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 64 - 248
Target Start/End: Complemental strand, 7890120 - 7889936
Alignment:
| Q |
64 |
ctacgaatcggtgatactgatgataagaatacatgaattagaaaaataggaggaatttacgtaccttcgaaggaagctgcgatggacgcggggaggagaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7890120 |
ctacgaatcggtgatactgatgataagaatacatgaattagaaaaataggaggaatttacgtaccttcgaaggaagctgcgatggacgcggggaggagaa |
7890021 |
T |
|
| Q |
164 |
agatggtagagaagagtagttaaagaatttcctgtcagatgtcaaaaatgagcagctttcagtattgctaaggatgcatgcagtg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7890020 |
agatggtagagaagagtagttaaagaatttcctgtcagatgtcaaaaatgagcagctttcagtattgctaaggatgcatgcagtg |
7889936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 194 - 248
Target Start/End: Complemental strand, 7914333 - 7914279
Alignment:
| Q |
194 |
cctgtcagatgtcaaaaatgagcagctttcagtattgctaaggatgcatgcagtg |
248 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||||| |||||||||||||||| |
|
|
| T |
7914333 |
cctgtcagatgtccaaaatgagcacctttcggtattgaaaaggatgcatgcagtg |
7914279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University