View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16291_low_16 (Length: 234)
Name: NF16291_low_16
Description: NF16291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16291_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 8851355 - 8851570
Alignment:
| Q |
1 |
atttattgaaggagttggatgtgattttggagaactgtagtaatttttctgtgcagaaggtttcagagaaggcgaagaagggagaggttttggatggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8851355 |
atttattgaaggagttggatgtgattttggagaactgtagtaatttttctgtgcagaaggtttcggagaaggcgaagaagggagaggttttggatggaaa |
8851454 |
T |
|
| Q |
101 |
tttggcgaaggaggtatcgccgaaggatttggagtcatcgaagaagaagaaggagatgatggaggggcaatgtgcggcgtattggactacattggcaccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8851455 |
tttggcgaaggaggtatcgccgaaggatttggagtcatcgaagaagaagaaggagatgatggaggggcaatgtgcggcgtattggactacattggcaccg |
8851554 |
T |
|
| Q |
201 |
aatgtggaggagtata |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8851555 |
aatgtggaggagtata |
8851570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 216
Target Start/End: Complemental strand, 31870379 - 31870303
Alignment:
| Q |
140 |
gaagaagaagaaggagatgatggaggggcaatgtgcggcgtattggactacattggcaccgaatgtggaggagtata |
216 |
Q |
| |
|
|||| |||||||||| ||||||||| | |||||| || ||||||||||||||||| || ||||||||||| |||| |
|
|
| T |
31870379 |
gaaggagaagaaggaattgatggaggagagatgtgctgcctattggactacattggctcctaatgtggaggattata |
31870303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University