View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16291_low_9 (Length: 344)
Name: NF16291_low_9
Description: NF16291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16291_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 18 - 303
Target Start/End: Original strand, 3641144 - 3641429
Alignment:
| Q |
18 |
atcattctggtggtatgatcctactgctgttgtggttttggattgtgttggttttgatgattctgtccccaaaatagcagtgaaatcgttgtttaagcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3641144 |
atcattctggtggtatgatcctactgctgttgtggttttggattgtgttggttttgatgattctgtctccaaaatagcagtgaaatcgttgtttaagcca |
3641243 |
T |
|
| Q |
118 |
ttggaaagaatccaagattactcgaagaaatgtatgaaattggaaagattgtcttgtggcaagcaaggttgatctacttacatcccaggtttcacttaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641244 |
ttggaaagaatccaagattactcgaagaaatgtatgaaattggaaagattgtcttgtggcaagcaaggttgatctacttacatcccaggtttcacttaca |
3641343 |
T |
|
| Q |
218 |
aagttagatagagggattccacaagatgcaagtgctggatgaacgccctagttaagcgcaatttttctattctttgttttacacct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641344 |
aagttagatagagggattccacaagatgcaagtgctggatgaacgccctagttaagcgcaatttttctattctttgttttacacct |
3641429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 123
Target Start/End: Complemental strand, 35677721 - 35677643
Alignment:
| Q |
45 |
tgttgtggttttggattgtgttggttttgatgattctgtccccaaaatagcagtgaaatcgttgtttaagccattggaa |
123 |
Q |
| |
|
|||| ||||| |||||||||||| |||||||| |||| |||| | || ||| ||||| |||||||||||| |||||||| |
|
|
| T |
35677721 |
tgttatggttgtggattgtgttgattttgatggttctttcccgagaacagctgtgaagtcgttgtttaaggcattggaa |
35677643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University