View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16293_high_4 (Length: 248)
Name: NF16293_high_4
Description: NF16293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16293_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 92 - 241
Target Start/End: Original strand, 29960821 - 29960970
Alignment:
| Q |
92 |
gttgcttttgaggctataccattctggggtgaaaggaattattgccaagtgcttttctattatcgtgattgccaagttacaccgttaaacggagggagta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29960821 |
gttgcttttgaggctataccattctggggtgaaaggaattattgccaagtgcttttctattatcgtggttgccaagttacaccgttaaacggagggagta |
29960920 |
T |
 |
| Q |
192 |
tcaaatactgcaannnnnnnnaagattcaaaagctgatatgtgatgatgt |
241 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29960921 |
tcaaatactgcaattttttttaagattcaaaagctgatatgtgatgatgt |
29960970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University