View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16293_high_4 (Length: 248)

Name: NF16293_high_4
Description: NF16293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16293_high_4
NF16293_high_4
[»] chr1 (1 HSPs)
chr1 (92-241)||(29960821-29960970)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 92 - 241
Target Start/End: Original strand, 29960821 - 29960970
Alignment:
92 gttgcttttgaggctataccattctggggtgaaaggaattattgccaagtgcttttctattatcgtgattgccaagttacaccgttaaacggagggagta 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
29960821 gttgcttttgaggctataccattctggggtgaaaggaattattgccaagtgcttttctattatcgtggttgccaagttacaccgttaaacggagggagta 29960920  T
192 tcaaatactgcaannnnnnnnaagattcaaaagctgatatgtgatgatgt 241  Q
    |||||||||||||        |||||||||||||||||||||||||||||    
29960921 tcaaatactgcaattttttttaagattcaaaagctgatatgtgatgatgt 29960970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University