View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16294_low_2 (Length: 407)
Name: NF16294_low_2
Description: NF16294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16294_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 45346304 - 45346059
Alignment:
| Q |
1 |
actccaatccatggctctctgctcaaggtttcttaattcattcatttccctctcctgctcaatattcaactgttgctcatgtttcttgtctttttcttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346304 |
actccaatccatggctctctgctcaaggtttcttaattcattcatttccctctcctgctcaatattcaactgttgctcatgtttcttgtctttttcttat |
45346205 |
T |
 |
| Q |
101 |
agtccatgtggaatctgttactcctttgaactcgatcaagaagcatctgaacggtgaaggaaaagttccgagtatcgtagctgttatcaaatcatgcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346204 |
agtccatgtggaatctgttactcctttgaactcgatcaagaagcatctgaacggtgaaggaaaagttccgagtatcgtagctgttatcaaatcatgcact |
45346105 |
T |
 |
| Q |
201 |
cctaacggttttggagacatgacggttaccctaaaggtcctgttct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346104 |
cctaacggttttggagacatgacggttaccctaaaggtcctgttct |
45346059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 281 - 406
Target Start/End: Complemental strand, 45346019 - 45345894
Alignment:
| Q |
281 |
atgcttctgattcaagagtttgagtttcaggatcctacaggttcagttggtgctagtatccaccgcaaagtcttcactgaaggaggatttagaaaggata |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346019 |
atgcttctgattcaagagtttgagtttcaggatcctacaggttcagttggtgctagtatccaccgcaaagtcttcactgaaggaggatttagaaaggata |
45345920 |
T |
 |
| Q |
381 |
taactgttggttctgtgctccttctc |
406 |
Q |
| |
|
|||||||||||||||| || |||||| |
|
|
| T |
45345919 |
taactgttggttctgttctacttctc |
45345894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University