View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16294_low_6 (Length: 257)
Name: NF16294_low_6
Description: NF16294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16294_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 7108861 - 7108631
Alignment:
| Q |
1 |
ttttaatgaaaacatttgtaattggatagaggtcattttaaactcatattctctgataatttctctcaatgataagcttcatgattattttcattgtaag |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108861 |
ttttaatgaaaacatttggaattggatagaggtcattttaaactcatattgtctgataatttctctcaatgataagcttcatgattattttcattgtaag |
7108762 |
T |
|
| Q |
101 |
agaggggtgaggcaggaatactgtatctatctctcctctccttttatgttttgccaaagaggtgatgagcagaagtatttctagattggtggatgaaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7108761 |
agaggggtgaggcaggaatactgt----atctctcctctccttttatgttttgccaaagaggtgatgagcagaggtatttctagattggtggatgaaggt |
7108666 |
T |
|
| Q |
201 |
aagctagaccttatcaaggggtccagaaaaccata |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108665 |
aagctagaccttatcaaggggtccagaaaaccata |
7108631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University