View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16295_high_9 (Length: 243)
Name: NF16295_high_9
Description: NF16295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16295_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 5960797 - 5960580
Alignment:
| Q |
11 |
cataggaacgtaaatccttgacagctttcttgatctcactctttgtataacaaccgtccttattgctatctgctttttccaatacttccattattttcct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960797 |
cataggaacgtaaatccttgacagctttcttgatctcactctttgtataacaaccgtccttattgctatctgctttttccaatacttccattattttcct |
5960698 |
T |
|
| Q |
111 |
ttctgctttgatttgatcttgagaaattgtcttcttgttatcagggcgtagtataggcattatgaaattattagtattgctctctaatctcaagttggtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960697 |
ttctgctttgatttgatcttgagaaattgtcttcttgttatcagggcgtagtataggcattatgaaattattagtattgctctctaatctcaagttggtg |
5960598 |
T |
|
| Q |
211 |
tgttgttggagtttatat |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5960597 |
tgttgttggagtttatat |
5960580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 93
Target Start/End: Complemental strand, 5954548 - 5954471
Alignment:
| Q |
16 |
gaacgtaaatccttgacagctttcttgatctcactctttgtataacaaccgtccttattgctatctgctttttccaat |
93 |
Q |
| |
|
|||| ||||||||| | |||||| |||| ||| |||||| |||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
5954548 |
gaacctaaatcctttagagcttttttgagctcttcctttgtgtaacgaccgtcgttattgatatctgctttttccaat |
5954471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University