View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16295_low_12 (Length: 236)
Name: NF16295_low_12
Description: NF16295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16295_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 37 - 215
Target Start/End: Original strand, 51858087 - 51858265
Alignment:
| Q |
37 |
ttcgattccgtagtgtctgtgctttatggcgctctattctttcccctccttttcatagacttcatattcaagctgctaagtttttgctactcaccgaaac |
136 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51858087 |
ttcgattccgtagtgcctgtgctttatggcgctctattctttcccctccttttcatagacttcatattcaagctgctaagtttttgctactcaccgaaac |
51858186 |
T |
 |
| Q |
137 |
caaaatatttcgcacacaaccattgttgccaacttcgaaatctagcaaacttcgtcacttagatattttgactaacaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51858187 |
caaaatatttcgcacacaaccattgttgccaacttcgaaatctagcaaacttcgtcacttagatattttgactaacaat |
51858265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 170
Target Start/End: Complemental strand, 34865455 - 34865308
Alignment:
| Q |
35 |
tcttcgattccgtagtgtctgtgctttatggcgctctattctttcccctccttt------------tcatagacttcatattcaagctgctaagtttttg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||| ||||| |||| || || |||||||||| |
|
|
| T |
34865455 |
tcttcgattccgtagtgtctgtgctttattgcgctctattcttccccctccttttccttctccttctcatacacttcgcattccagatggtaagtttttg |
34865356 |
T |
 |
| Q |
123 |
ctactcaccgaaaccaaaatatttcgcacacaaccattgttgccaact |
170 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
34865355 |
cttttcaccgaaaccaaaatatttcgcctacaaccattatttccaact |
34865308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University