View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16299_low_2 (Length: 336)
Name: NF16299_low_2
Description: NF16299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16299_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 18 - 323
Target Start/End: Complemental strand, 40063706 - 40063401
Alignment:
| Q |
18 |
caaagttagtaccaattccaaccccagcctgcagatgagtgagttttgccaaactagcacgcctcaatataaactgtcccactcccttcacatgtccttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40063706 |
caaagttagtaccaattccaaccccagcctgcagatgagtgagttttgccaaactagcacgcctcaatataaactgtcccactcccttcacatgtccttc |
40063607 |
T |
 |
| Q |
118 |
actctctaccatcctttcatcccatacttttctcggttcaccccctcactccactattgcaaataaatcatcttaatacccacataacaattcatatcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40063606 |
actctctaccatcctttcatcccatacttttctctgttca-cccctcactccactattgcaaataaaccatcttaatacccacataacaattcatatcat |
40063508 |
T |
 |
| Q |
218 |
ccttcaccattctcattaatag-taatagtatttctcatttacgcttcagtagtgttggtcacatccattgattcattgcgtgcgtcagtgtatatatat |
316 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40063507 |
ccttcaccattctcattaatagttaatagtatttctcatttacgcttcagtagtgttggtcacatccattgattcattgcgtgcgtcagtgtatatatat |
40063408 |
T |
 |
| Q |
317 |
gtaagta |
323 |
Q |
| |
|
||||||| |
|
|
| T |
40063407 |
gtaagta |
40063401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University