View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1629_high_11 (Length: 284)

Name: NF1629_high_11
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1629_high_11
NF1629_high_11
[»] chr5 (3 HSPs)
chr5 (172-267)||(24400231-24400326)
chr5 (180-220)||(24407053-24407093)
chr5 (56-95)||(24400126-24400165)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 172 - 267
Target Start/End: Original strand, 24400231 - 24400326
Alignment:
172 ttgtttacttttcatgcagggaggtgaatgaggaatatggcaagtacctacgggaagtggcagacaaactattcaaaagcctgtcaattgggcttg 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
24400231 ttgtttacttttcatgcagggaggtgaatgaggaatatggcaagtacctacgtgaagtggcagacaaactattcaaaagcctgtcaattgggcttg 24400326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 24407053 - 24407093
Alignment:
180 ttttcatgcagggaggtgaatgaggaatatggcaagtacct 220  Q
    ||||| |||||||||||||||||||||||||||||||||||    
24407053 ttttcttgcagggaggtgaatgaggaatatggcaagtacct 24407093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 56 - 95
Target Start/End: Original strand, 24400126 - 24400165
Alignment:
56 atttttcatatgcaagtttggtctattctattaaaaggag 95  Q
    ||||||||||||| ||||||||||||||||||||||||||    
24400126 atttttcatatgcgagtttggtctattctattaaaaggag 24400165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University