View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_high_11 (Length: 284)
Name: NF1629_high_11
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 172 - 267
Target Start/End: Original strand, 24400231 - 24400326
Alignment:
| Q |
172 |
ttgtttacttttcatgcagggaggtgaatgaggaatatggcaagtacctacgggaagtggcagacaaactattcaaaagcctgtcaattgggcttg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24400231 |
ttgtttacttttcatgcagggaggtgaatgaggaatatggcaagtacctacgtgaagtggcagacaaactattcaaaagcctgtcaattgggcttg |
24400326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 24407053 - 24407093
Alignment:
| Q |
180 |
ttttcatgcagggaggtgaatgaggaatatggcaagtacct |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24407053 |
ttttcttgcagggaggtgaatgaggaatatggcaagtacct |
24407093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 56 - 95
Target Start/End: Original strand, 24400126 - 24400165
Alignment:
| Q |
56 |
atttttcatatgcaagtttggtctattctattaaaaggag |
95 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24400126 |
atttttcatatgcgagtttggtctattctattaaaaggag |
24400165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University