View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_high_13 (Length: 243)
Name: NF1629_high_13
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 6 - 235
Target Start/End: Complemental strand, 52445161 - 52444936
Alignment:
| Q |
6 |
ttatctcacaagaatgatgtggtcaaaatatatgatcgacaactagatagatttggtgtacatttgttggaggaaaaatgtcacaatgagacaaaataaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
52445161 |
ttatctcacaagaatgatgtggtcaaaatatatgatcgacaactagatagatttggtgtacatttgttggatgaaaaatgttacaatgagacaaaataaa |
52445062 |
T |
 |
| Q |
106 |
gttattgacaattctgtataaccgtacgtaccgttgtgggagctggcttaagagaaattcttgcccttgttataactccaaattgtcctaaacctccaag |
205 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52445061 |
gttattgacaattctgtataacc----gtaccgttgtgggagctggcttaagagaaattcttgcccttgttataactccaaattgtcctaaacctccaag |
52444966 |
T |
 |
| Q |
206 |
aaccgcgtgatataactctgaattcttctc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52444965 |
aaccgcgtgatataactctgaattcttctc |
52444936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 17277293 - 17277232
Alignment:
| Q |
147 |
gctggcttaagagaaattcttgcccttgttataactccaaattgtcctaaacctccaagaac |
208 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
17277293 |
gctggctcaagagctattcttgcccttgttataattccaaattgtcctaatcctccaagaac |
17277232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University