View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_high_15 (Length: 235)
Name: NF1629_high_15
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 7 - 200
Target Start/End: Complemental strand, 10604994 - 10604801
Alignment:
| Q |
7 |
tgaatataataatatgttactagataaaaagagagtagaacacttacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604994 |
tgaatataataatatgttactagataaaaagaaagtagaacacttacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaa |
10604895 |
T |
 |
| Q |
107 |
atccatgcttgacaatgatctgaaatactagcaaccaattgttaaccccatgtcagacaattcaggagaggtttgcttcatttaataatttaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
10604894 |
atccatgcttgacaatgatctgaaatactagcaaccaattgttaaacccatgtcagacaactcaggagaggtttacttcatttaataatttaag |
10604801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 117
Target Start/End: Complemental strand, 32212941 - 32212875
Alignment:
| Q |
51 |
tacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaaatccatgcttg |
117 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| | | ||||||| |||||||||||||||||||| |
|
|
| T |
32212941 |
tacaaaatccacaattcagatagtaatccaatatgttctgaaagctagccagacaaatccatgcttg |
32212875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University