View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_high_16 (Length: 233)
Name: NF1629_high_16
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 9585010 - 9584785
Alignment:
| Q |
1 |
tgatctttgaaaaattaatctctatatttgtgtgtggatttattcaacattgttacaataggtagaaaggcatgcaagtttcagccaatattactaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9585010 |
tgatctttgaaaaattaatctctatatttgcgtgtggatttattcaacattgttacaataggtagaaaggcatgcaagtttcagccaatattactaatac |
9584911 |
T |
 |
| Q |
101 |
aagtcttaactttattaaccttctggagctcattgttccatctaatatcttaaactactataaaactatgtcataaccctaaccatagtattgatactta |
200 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| || ||| ||||||| || |||||||||||| |
|
|
| T |
9584910 |
aagtcttgactttattaaccttatggagctcattgttccatctaatatcttaaactactatgaaactacgtggtaatcctaaccctactattgatactta |
9584811 |
T |
 |
| Q |
201 |
agatgaaagacgtgtatgatgatgtc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
9584810 |
agatgaaagacgtgtatgatgatgtc |
9584785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University