View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_high_17 (Length: 230)
Name: NF1629_high_17
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 45479441 - 45479643
Alignment:
| Q |
1 |
aaaggtttaacttacttgtaatcatccttgtgatttttctttaattctctctgcttttgattcggttcttttaatcatataggtgaagttgatgaatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45479441 |
aaaggtttaacttacttgtaatcatccttgtgatttttctttaattctctctgcttttgattcggttcttttaatcatataggtgaagttgaggaatcat |
45479540 |
T |
 |
| Q |
101 |
acaacctgtttttgttgtacagttttgaaggagtataaagaaagattcctgaaaaagtagcagtagctcaaatataaaatgtatgaaaaagatgatctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45479541 |
acaacctgtttttgttgtacagttttgaaggagtataaagaaagattcctgaaaaagtagcagtagctcaaatataaaatgtatgaaaaagatgatctct |
45479640 |
T |
 |
| Q |
201 |
gct |
203 |
Q |
| |
|
||| |
|
|
| T |
45479641 |
gct |
45479643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University