View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_low_22 (Length: 225)
Name: NF1629_low_22
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 119 - 211
Target Start/End: Original strand, 36763584 - 36763676
Alignment:
| Q |
119 |
aacaaaatgttgatatcatctaaaattgtataaaacaaaaaattaaatcatatttggttgtgtgccgcgttgacatttctcatgttcctatgc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36763584 |
aacaaaatgttgatatcatctaaaattgtataaaacaaaaaattaaatcatatttggttgtgtgccgcgttgacatttctcatgttcctatgc |
36763676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 23 - 80
Target Start/End: Original strand, 36763488 - 36763545
Alignment:
| Q |
23 |
gtcaacacccctggtgtcacagctgatgttagtcacatggacactggtgctgtggtaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36763488 |
gtcaacacccctggtgtcacagctgatgttagtcacatggacactggtgctgtggtaa |
36763545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University