View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_low_25 (Length: 212)
Name: NF1629_low_25
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 21 - 206
Target Start/End: Complemental strand, 38234975 - 38234790
Alignment:
| Q |
21 |
acgtcgacaatggttttcaagataactagacccacaaaattaatccaacgcaattagcaacagatctatcatatccttgccttgactcaagagacttcca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38234975 |
acgtcgacaatggttttcaagataactagacccacaaaattaatccaacgcaattagcaacagatctatcatatccttgccttgactcaagagacttcca |
38234876 |
T |
 |
| Q |
121 |
tcatattactctcttaaaatactacttaaattagttctatatgtttcattattttctaataaactatcatattttcttcgacatcc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
38234875 |
tcatattactctcttaaaatactacttaaattagttctatatgtttcattattttctaataaactatcatattttatttgacatcc |
38234790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University