View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1629_low_9 (Length: 316)
Name: NF1629_low_9
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1629_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 306
Target Start/End: Original strand, 33254279 - 33254573
Alignment:
| Q |
17 |
atcctttttatgaattggtacaataatgg-----gatgggatgagacatacttaacaatatcaacatttttgtttcgttccagttcacgcatcatattag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33254279 |
atcctttttatgaattggtacaataatgggatgggatgggatgagacatacttaacaatatcaacatttttgtttcgttccagttcacgcatcatattag |
33254378 |
T |
|
| Q |
112 |
tatacgtttggtttcctgttgaaaccacataacgtctcgcgttccaattcacttttcccgcagaatttgtgaagatcttgtcatgccttttcaccgcaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33254379 |
tatacgtttggtttcctgttgaaaccacataacgtcttgcgttccaattcacttttcccgcagaatttgtgaagatcttgtcatgccttttcaccgcaat |
33254478 |
T |
|
| Q |
212 |
tctacaatcctgccgccaaaccaaactggcgcttacagagtatttacttaacacnnnnnnncaggcccattgccaccattatccatgtttctgtg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33254479 |
tctacaatcctgccgccaaaccaaactggcgcttagagagtatttatttaacactttttttcaggcccattgccaccattatccatgtttctgtg |
33254573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University