View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16302_high_3 (Length: 366)
Name: NF16302_high_3
Description: NF16302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16302_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 58 - 358
Target Start/End: Original strand, 38613371 - 38613671
Alignment:
| Q |
58 |
gatttattattttgtatgttcacaacagtatggaaattgagctttatgaagcttcagtcaaaatgtatgattcttgataaggaattttaaggagaaaatg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38613371 |
gatttattattttgtatgttcacaacagtatgaaaattgagctttatgaagcttcagtcaaaatgtataattcttgataaggaattttaaggagaaaatg |
38613470 |
T |
 |
| Q |
158 |
gtccagagtgtgtggacatgatagaagatgctttgtcttgcatatgaaacgtaaaggtaggttcgtcaaaaatctttttcctctgtatcttccttccatc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38613471 |
gtccagagtgtgtggacatgatagaagatgcttcgtcttgcatatgaaacgtaaaggtaggttcgtcaaaaatctttttcctctgtatcttccttccatc |
38613570 |
T |
 |
| Q |
258 |
cttaatgaaggatacaccttgatttcctgaatttatgttgtttgatcccagttgttggatacccattgggagccttttgttcatgggtggagaataatct |
357 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38613571 |
cttaatgaaggatataccttgatttcctgaatttatgttgtttgatcccagttgttggatacccattgggagccttttgttcatgggtggagaataatct |
38613670 |
T |
 |
| Q |
358 |
a |
358 |
Q |
| |
|
| |
|
|
| T |
38613671 |
a |
38613671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 38613338 - 38613274
Alignment:
| Q |
1 |
gcccgaattgattaactcatgcttaacgtcaactgcaaacagattaattagtttattgatttatt |
65 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38613338 |
gcccgaattgattaactcatgcttaatgtcaactgcaaacagattaattagtttattgatttatt |
38613274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University