View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16303_low_3 (Length: 243)
Name: NF16303_low_3
Description: NF16303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16303_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 32133059 - 32132843
Alignment:
| Q |
11 |
ttattctatgaccttaacgtaggaattaaggggaatcatatcatagtactactagattacagttttgcatacaattatttcatattaataaatgctgaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||| ||| |
|
|
| T |
32133059 |
ttattctatgaccttaacgtaggaattaaggggaaccatatcatagtactactagattacaattttgtatacaattatttcatattattaaatgctcaca |
32132960 |
T |
|
| Q |
111 |
tactgttcctagttttgtgaatattcattttttgaagatgcagtttcttggtgataagaagatacttcaaagacagagagtaccattcctttgctgacaa |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32132959 |
tactgttcctagtcttgtgaatattcattttttgaagatgcagtttcttggtgataagaagatacttcaaagacagagagtaccattcctttgctgccaa |
32132860 |
T |
|
| Q |
211 |
actttggatgatatgac |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32132859 |
actttggatgatatgac |
32132843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University