View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16305_high_1 (Length: 245)
Name: NF16305_high_1
Description: NF16305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16305_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 38334112 - 38333888
Alignment:
| Q |
17 |
ccacttatctgattgtgaatatgaccgtgtagatgatttgtaattttattcgcaagctttctcaggttgctaatgagagnnnnnnntctctaaagaagca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38334112 |
ccacttatctgattgtgaatatgaccgtgtagatgatttgtaattttattcgcaagctttctcaggttgctaatgagagaaaaaaatctctaaagaagca |
38334013 |
T |
 |
| Q |
117 |
taaaatatcttctattgctggtgtggaggataaaggtggtaaatcctcaaggaaaccaagaaaacaagcagctagtaaacctactaaaaactcattgaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38334012 |
taaaatatcttctattgctggtgtggaggataaaggtggtaaatcctcaaggaaaccaagaaaacaagcagctagtaaacctactaaaaactcattgaat |
38333913 |
T |
 |
| Q |
217 |
gaggctgttaacggtgatgatgtcc |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38333912 |
gaggctgttaacggtgatgatgtcc |
38333888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 104 - 241
Target Start/End: Complemental strand, 38341778 - 38341641
Alignment:
| Q |
104 |
ctctaaagaagcataaaatatcttctattgctggtgtggaggataaaggtggtaaatcctcaaggaaaccaagaaaacaagcagctagtaaacctactaa |
203 |
Q |
| |
|
|||||||||||||||||| |||| |||||| ||||||||||||||||||| ||||| |||||||| | || ||||||||||||| | || ||| |||| |
|
|
| T |
38341778 |
ctctaaagaagcataaaagatctcctattgttggtgtggaggataaaggtagtaaaacctcaaggcagccgagaaaacaagcagttcgtgaactgtctaa |
38341679 |
T |
 |
| Q |
204 |
aaactcattgaatgaggctgttaacggtgatgatgtcc |
241 |
Q |
| |
|
|||| |||| || |||||||| | | ||||||||||| |
|
|
| T |
38341678 |
aaacccatttaacaaggctgttgaggttgatgatgtcc |
38341641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University