View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16306_low_3 (Length: 465)
Name: NF16306_low_3
Description: NF16306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16306_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 2e-75; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 52391477 - 52391653
Alignment:
| Q |
14 |
caaagggaaaaggaacataaaaaatttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacaggaattctgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52391477 |
caaagggaaaaggaacataaaaaatttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaac------cctgt |
52391570 |
T |
|
| Q |
114 |
tccaattttgagagtttaaaaggtatgagaagggatggcttcagaggtggaaaatataggagggaatgtggaaatcttgtaca |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391571 |
tccaattttgagagtttgaaaggtatgagaagggatgacttcagagttggaaaatataggagggaatgtggaaatcttgtaca |
52391653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 235 - 297
Target Start/End: Original strand, 52393037 - 52393099
Alignment:
| Q |
235 |
acaagattaaatgacgaagcatagaagtacttttactaaaagataagactagttgtttagcag |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52393037 |
acaagattaaatgacgaagcatagaagtacttttactaaaagataagactagttgtttagcag |
52393099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 383
Target Start/End: Original strand, 52393122 - 52393166
Alignment:
| Q |
339 |
agacactagaggatgcaatttgccaatagaactagggcaagacaa |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52393122 |
agacactagaggatgcaatttgccaatagaactagggcaagacaa |
52393166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 447
Target Start/End: Original strand, 47476232 - 47476297
Alignment:
| Q |
382 |
aatcttgggttgagaaatgtgctacctccggaggtgtctacgttatgtgtgatgtgcaatgcgaag |
447 |
Q |
| |
|
||||||| |||||| |||||| |||| ||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
47476232 |
aatcttgcgttgaggaatgtgttaccaccggaagcgtctacgttatgtgtgatgtgcaatgtgaag |
47476297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 392 - 442
Target Start/End: Complemental strand, 40931846 - 40931796
Alignment:
| Q |
392 |
tgagaaatgtgctacctccggaggtgtctacgttatgtgtgatgtgcaatg |
442 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
40931846 |
tgaggaatgtcctacctctggaggtgtctacgttatgtgtaatgtgtaatg |
40931796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University