View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16307_high_20 (Length: 316)
Name: NF16307_high_20
Description: NF16307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16307_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 39231475 - 39231164
Alignment:
| Q |
1 |
aaaaactcattcccacaaacttgttcaacttcaccagaaaaatcatgcaaaaacacatgagtctttgggttaccacctttcttacttctagccaacaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231475 |
aaaaactcattcccacaaacttgttcaacttcaccagaaaaatcatgcaaaaacacatgagtctttgggttaccacctttcttacttctagccaacaccc |
39231376 |
T |
|
| Q |
101 |
cggctgtaaatatcgccgacattctcccgggagcttccggccaatccccacgaggcccgtcaaccaatattacatcccaatcaacttcatacacatggtt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231375 |
cggcggtaaatatcgccgacattctcccgggagcttccggccaatccccacgaggcccgtcaaccaatattacatcccaatcaacttcatacacatggtt |
39231276 |
T |
|
| Q |
201 |
tggaagatcattaattccaagtttgcaatccgagaataaaagattctgcactggcttgcactcatttgctacatgttctttagctgaagctataagctct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231275 |
tggaagatcattaattccaagtttgcaatccgagaataaaagattctgcactggcttgcactcatttgctacatgttctttagctgaagctataagctct |
39231176 |
T |
|
| Q |
301 |
ttcatctcactc |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39231175 |
ttcatctcactc |
39231164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 78 - 140
Target Start/End: Original strand, 33371810 - 33371872
Alignment:
| Q |
78 |
tttcttacttctagccaacaccccggctgtaaatatcgccgacattctcccgggagcttccgg |
140 |
Q |
| |
|
|||||| || ||||||||||| | |||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
33371810 |
tttcttgctcctagccaacactgctgctgtaaagatcgccgacattctccccggagctgccgg |
33371872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University