View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1630_high_4 (Length: 287)
Name: NF1630_high_4
Description: NF1630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1630_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 232
Target Start/End: Original strand, 42662961 - 42663184
Alignment:
| Q |
9 |
gattatactcataaccatggcatccatttttactcctatttctttggtatctggtggaaggaagggactgaaaatgaagattcgggttggccatatctgg |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662961 |
gattttactcataaccatggcatccatttttactccaatttctttggtatctggtggaaggaagggactgaaaatgaagattcgggttggccatatctga |
42663060 |
T |
|
| Q |
109 |
tgcattcctgacaaagagaatccaaacgagatcagctgcatgaaccttcttctggtggatgagcagttatgtctgtcgatatcattcaggtgtaaataga |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42663061 |
tgcattcctgacaaagagaatcctaacgagatcagctgcatgaaccttcttctggtggatgagacgttatgtctgtcgatatcattcaggtgtaaataga |
42663160 |
T |
|
| Q |
209 |
atgagaagttattataagattcag |
232 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42663161 |
atgagaagttattataagattcag |
42663184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 271
Target Start/End: Original strand, 42663198 - 42663226
Alignment:
| Q |
243 |
aatgtttattttgaaattttatatggatt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42663198 |
aatgtttattttgaaattttatatggatt |
42663226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University