View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1631-INSERTION-6 (Length: 90)
Name: NF1631-INSERTION-6
Description: NF1631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1631-INSERTION-6 |
![](./plan/images/spacer.gif) | ![NF1631-INSERTION-6](./plan/images/spacer.gif) |
|
[»] chr1 (1 HSPs) |
![](./plan/images/spacer.gif) | ![chr1 (7-90)||(34781555-34781638)](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 7 - 90
Target Start/End: Complemental strand, 34781638 - 34781555
Alignment:
Q |
7 |
aaatattgtattcacaacaaatacaaaatgaaattactttcattatttgtccattcaaagtgtaaaattgtttcatctctatat |
90 |
Q |
|
|
|||||||||| |||| |||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34781638 |
aaatattgtactcactacaagtacaaattaaaattactttcattatttgtccattcaaagtgtaaaattgtttcatctctatat |
34781555 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13122 times since January 2019
Visitors: 1134