View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16310_high_5 (Length: 221)
Name: NF16310_high_5
Description: NF16310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16310_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 13 - 204
Target Start/End: Complemental strand, 2924212 - 2924021
Alignment:
| Q |
13 |
gcacagaagattagaagaacggttattgactgcttcgagagagcgaatttgcctgctgtaagtgaggaagaaaagaagagaattcttcattttgctattg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2924212 |
gcacagaagattagaagaacggttattgactgcttcgagagagcgaatttgcctgatgtaagcgaggaagaaaagaagagaattcttcattttgctattg |
2924113 |
T |
|
| Q |
113 |
ttggaggagggccaactggagtggagttcgcagcttcacttcatgacttcgtcaacgaggatttagtccatttatatcctggggtcaaagat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2924112 |
ttggaggagggccaactggagtggagttcgcagcttcacttcatgacttcgtcaacgaggatttagtccatttatatcctggggtcaaagat |
2924021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 36126672 - 36126863
Alignment:
| Q |
13 |
gcacagaagattagaagaacggttattgactgcttcgagagagcgaatttgcctgctgtaagtgaggaagaaaagaagagaattcttcattttgctattg |
112 |
Q |
| |
|
||||| |||||||||||||| || |||||| |||| |||||||| | ||||||| ||| ||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
36126672 |
gcacaaaagattagaagaactgtaattgacagctttgagagagcaagtttgcctagtgtgagtgatgaagagagaaagagaattcttcattttgctattg |
36126771 |
T |
|
| Q |
113 |
ttggaggagggccaactggagtggagttcgcagcttcacttcatgacttcgtcaacgaggatttagtccatttatatcctggggtcaaagat |
204 |
Q |
| |
|
||||||| || ||||||||||| ||||| ||||| |||||||||| || |||| |||||||| ||| | ||||| |||||||| |||||| |
|
|
| T |
36126772 |
ttggaggtggtccaactggagtagagtttgcagccgcacttcatgattttgtcagtgaggatttggtcaaattataccctggggtaaaagat |
36126863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University